ID: 1034107239_1034107246

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1034107239 1034107246
Species Human (GRCh38) Human (GRCh38)
Location 7:148500945-148500967 7:148500981-148501003
Sequence CCCCTACAATGCCTCCTCCATGT TTTATTTCTTGAAACCCAGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 39, 4: 361}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!