ID: 1034130696_1034130697 |
View in Genome Browser |
Spacer: -9 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1034130696 | 1034130697 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 7:148714013-148714035 | 7:148714027-148714049 |
| Sequence | CCTGGCTGCATGTGTGTATATTT | TGTATATTTATATAATTAGAAGG |
| Strand | - | + |
| Off-target summary | {0: 1, 1: 2, 2: 8, 3: 33, 4: 541} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||