ID: 1034147025_1034147044

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1034147025 1034147044
Species Human (GRCh38) Human (GRCh38)
Location 7:148883491-148883513 7:148883534-148883556
Sequence CCCCGCCGCGAACGTCGTCCCGC GGGGTCGGCGCGCCCGGGACCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 25} {0: 1, 1: 0, 2: 3, 3: 17, 4: 197}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!