ID: 1034147317_1034147330

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1034147317 1034147330
Species Human (GRCh38) Human (GRCh38)
Location 7:148884423-148884445 7:148884472-148884494
Sequence CCACGCAGAGTGCGCTCAGGGCT GTGCGCGCGCGGGCGGCGGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 97} {0: 1, 1: 1, 2: 10, 3: 104, 4: 538}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!