ID: 1034192370_1034192377

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1034192370 1034192377
Species Human (GRCh38) Human (GRCh38)
Location 7:149222240-149222262 7:149222271-149222293
Sequence CCACGAGTGCAAGGAGGGCCTGT TGCCAAGGTCCAGGTGGGTCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 10, 4: 235}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!