ID: 1034214719_1034214725

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1034214719 1034214725
Species Human (GRCh38) Human (GRCh38)
Location 7:149396489-149396511 7:149396542-149396564
Sequence CCATGGGAGGCATTGAGGGCATG GCCATGGGCCATGAGTTCCATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 16, 4: 142}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!