ID: 1034218356_1034218357

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1034218356 1034218357
Species Human (GRCh38) Human (GRCh38)
Location 7:149424757-149424779 7:149424786-149424808
Sequence CCAAGCATGTTTGTATGCAATTA GTTTCAAGACTCTGAAGAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 171} {0: 1, 1: 1, 2: 2, 3: 20, 4: 185}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!