|  | Left Crispr | Right Crispr | 
    
    
      
        | Crispr ID | 1034219329 | 1034219340 | 
      
        | Species | Human (GRCh38) | Human (GRCh38) | 
      
        | Location | 7:149431944-149431966 | 7:149431994-149432016 | 
      
        | Sequence | CCGCTCGCCTGTGTGGATGCGCC | TGAAGCTCTTGCCGCACTCGGGG | 
      
        | Strand | - | + | 
      
        | Off-target summary | {0: 1, 1: 3, 2: 7, 3: 27, 4: 106} | {0: 2, 1: 4, 2: 13, 3: 29, 4: 72} | 
      
        | Status | Not started | 
    
  
 
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
  
    | Spacer | Left Crispr | Right Crispr | 
  
    |  | Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | 
  
  
    | No off target data available for this pair! |