ID: 1034222889_1034222898

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1034222889 1034222898
Species Human (GRCh38) Human (GRCh38)
Location 7:149459852-149459874 7:149459872-149459894
Sequence CCTCCGGGCGCCCCACCTCGGGG GGGCCGCGTGTGTGCCGGGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 190} {0: 1, 1: 0, 2: 2, 3: 39, 4: 280}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!