ID: 1034222891_1034222898

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1034222891 1034222898
Species Human (GRCh38) Human (GRCh38)
Location 7:149459855-149459877 7:149459872-149459894
Sequence CCGGGCGCCCCACCTCGGGGCCG GGGCCGCGTGTGTGCCGGGCCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 39, 4: 280}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!