ID: 1034233246_1034233256

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1034233246 1034233256
Species Human (GRCh38) Human (GRCh38)
Location 7:149548873-149548895 7:149548916-149548938
Sequence CCCTGCCCCTTCTGTGTTTATGA AAACACCAGATGTGCATGTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 38, 4: 317} {0: 1, 1: 0, 2: 0, 3: 14, 4: 161}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!