ID: 1034248089_1034248098

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1034248089 1034248098
Species Human (GRCh38) Human (GRCh38)
Location 7:149664538-149664560 7:149664554-149664576
Sequence CCCCTACTCCCATCAGGTACTGA GTACTGAGTAAGGGAACGGGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 12, 4: 145} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!