ID: 1034265877_1034265895

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1034265877 1034265895
Species Human (GRCh38) Human (GRCh38)
Location 7:149780454-149780476 7:149780505-149780527
Sequence CCGTGCGCCAGCTGTGTAACCCC TGGTGGCCAGGTGGTGCCCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 165} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!