ID: 1034267515_1034267526

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1034267515 1034267526
Species Human (GRCh38) Human (GRCh38)
Location 7:149788415-149788437 7:149788467-149788489
Sequence CCAGGTGGTGGCCTGTGTGGAGG CACGGTGTGTAGAGTGACAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 18, 4: 311} {0: 1, 1: 0, 2: 0, 3: 6, 4: 65}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!