ID: 1034276755_1034276761

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1034276755 1034276761
Species Human (GRCh38) Human (GRCh38)
Location 7:149827214-149827236 7:149827240-149827262
Sequence CCAGGAAGTGGAAGGTTCTTTCC CCAGTGAGGAAACTGAGGTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 165} {0: 1, 1: 0, 2: 22, 3: 166, 4: 942}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!