ID: 1034280520_1034280526

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1034280520 1034280526
Species Human (GRCh38) Human (GRCh38)
Location 7:149850769-149850791 7:149850808-149850830
Sequence CCTTTATAGAGTAGGAAATGTTT CAGGTGGATCAGAAGGAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 33, 4: 282} {0: 1, 1: 0, 2: 6, 3: 53, 4: 606}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!