ID: 1034282934_1034282947

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1034282934 1034282947
Species Human (GRCh38) Human (GRCh38)
Location 7:149866150-149866172 7:149866195-149866217
Sequence CCTTTCTTGCTTTCTGCCTTTGA CTGTGGGTCTGGCGGTCAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 132, 4: 1254} {0: 1, 1: 0, 2: 1, 3: 8, 4: 213}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!