ID: 1034282936_1034282941

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1034282936 1034282941
Species Human (GRCh38) Human (GRCh38)
Location 7:149866166-149866188 7:149866187-149866209
Sequence CCTTTGACCTGTGGAAATGTCTC TCCCAGCCCTGTGGGTCTGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 168} {0: 1, 1: 0, 2: 1, 3: 64, 4: 473}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!