ID: 1034282937_1034282950

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1034282937 1034282950
Species Human (GRCh38) Human (GRCh38)
Location 7:149866173-149866195 7:149866217-149866239
Sequence CCTGTGGAAATGTCTCCCAGCCC GACCCCACAGGCCTGTGGTGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 166} {0: 1, 1: 1, 2: 3, 3: 43, 4: 378}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!