ID: 1034304511_1034304512

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1034304511 1034304512
Species Human (GRCh38) Human (GRCh38)
Location 7:150038653-150038675 7:150038666-150038688
Sequence CCACGTAAGGTCGGAAGATTTGA GAAGATTTGAACTTTCTACTTGG
Strand - +
Off-target summary No data {0: 12, 1: 6, 2: 3, 3: 30, 4: 272}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!