ID: 1034304511_1034304515

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1034304511 1034304515
Species Human (GRCh38) Human (GRCh38)
Location 7:150038653-150038675 7:150038695-150038717
Sequence CCACGTAAGGTCGGAAGATTTGA AACACCCACAGTCCTCCAGGTGG
Strand - +
Off-target summary No data {0: 8, 1: 20, 2: 19, 3: 15, 4: 181}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!