ID: 1034344778_1034344796

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1034344778 1034344796
Species Human (GRCh38) Human (GRCh38)
Location 7:150379477-150379499 7:150379503-150379525
Sequence CCCCGCTCCTCCCGTGCTGCCTC CCGGCCCGGGCTGGGGCGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 52, 4: 433} {0: 1, 1: 0, 2: 7, 3: 61, 4: 454}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!