ID: 1034349146_1034349156

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1034349146 1034349156
Species Human (GRCh38) Human (GRCh38)
Location 7:150405266-150405288 7:150405311-150405333
Sequence CCGGCGACTGCGGCGCTGCAGCG GCGCCATGTGAGTGCGCGCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 73} {0: 1, 1: 0, 2: 1, 3: 4, 4: 44}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!