ID: 1034353435_1034353438

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1034353435 1034353438
Species Human (GRCh38) Human (GRCh38)
Location 7:150432282-150432304 7:150432299-150432321
Sequence CCAAACTACAGGGTGTCATGGAG ATGGAGAAACACAGTCTGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 76} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!