ID: 1034354541_1034354548

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1034354541 1034354548
Species Human (GRCh38) Human (GRCh38)
Location 7:150442400-150442422 7:150442450-150442472
Sequence CCACCAGGGCGACAGTGTTGTGT TATTGTGATGAACCCCAGCAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 3, 4: 87}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!