ID: 1034378383_1034378388

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1034378383 1034378388
Species Human (GRCh38) Human (GRCh38)
Location 7:150666607-150666629 7:150666647-150666669
Sequence CCATTTCTCCATGTGTGCTGGTT TGGGAAGACATTTGTACAGATGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!