ID: 1034385430_1034385440

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1034385430 1034385440
Species Human (GRCh38) Human (GRCh38)
Location 7:150737115-150737137 7:150737153-150737175
Sequence CCTGTGAGAAGGGGCCCAAGAGT TGCCCCGGTGATGGGTGCTGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 20, 4: 228}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!