ID: 1034387017_1034387022

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1034387017 1034387022
Species Human (GRCh38) Human (GRCh38)
Location 7:150748418-150748440 7:150748466-150748488
Sequence CCATACATGGATTGTTCACACTG AGCATCACATTTTACAGATGAGG
Strand - +
Off-target summary No data {0: 1, 1: 3, 2: 55, 3: 346, 4: 1601}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!