ID: 1034414749_1034414755

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1034414749 1034414755
Species Human (GRCh38) Human (GRCh38)
Location 7:150958502-150958524 7:150958534-150958556
Sequence CCTGCGGGAGAGGAGAGGCACGT GATCGCGAGCAGCCCCGGAGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 142} {0: 1, 1: 0, 2: 0, 3: 1, 4: 49}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!