ID: 1034415487_1034415493

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1034415487 1034415493
Species Human (GRCh38) Human (GRCh38)
Location 7:150962295-150962317 7:150962314-150962336
Sequence CCACAGCCAGCCAGGCCCTCGAA CGAACCTAAGTCCTCCACCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 262} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!