ID: 1034418719_1034418730

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1034418719 1034418730
Species Human (GRCh38) Human (GRCh38)
Location 7:150978165-150978187 7:150978207-150978229
Sequence CCCGCCGAGCCGCGGGGCCCGCT CGCTCCGCCCGCCCGAGCCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 189} {0: 1, 1: 0, 2: 3, 3: 26, 4: 273}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!