ID: 1034418727_1034418734

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1034418727 1034418734
Species Human (GRCh38) Human (GRCh38)
Location 7:150978197-150978219 7:150978215-150978237
Sequence CCCCGCGCTGCGCTCCGCCCGCC CCGCCCGAGCCCCGGACTCCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 64, 4: 502} {0: 1, 1: 0, 2: 3, 3: 26, 4: 209}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!