ID: 1034427810_1034427824

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1034427810 1034427824
Species Human (GRCh38) Human (GRCh38)
Location 7:151023845-151023867 7:151023881-151023903
Sequence CCCTCTCCCACCCACACCCACAC CCCTTCAGGGACATGAAGCAGGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 30, 3: 584, 4: 4327} {0: 1, 1: 0, 2: 2, 3: 14, 4: 219}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!