ID: 1034436022_1034436030

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1034436022 1034436030
Species Human (GRCh38) Human (GRCh38)
Location 7:151063131-151063153 7:151063158-151063180
Sequence CCGCATTCCCTGCCGGCTGTGCC GGCCGCTGCTCCGCGCCCGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 268} {0: 1, 1: 0, 2: 2, 3: 21, 4: 323}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!