ID: 1034445306_1034445315

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1034445306 1034445315
Species Human (GRCh38) Human (GRCh38)
Location 7:151111065-151111087 7:151111091-151111113
Sequence CCAACTTGGAGAGCCTGCTGGAC AGCCAGTCCTGGGGGGCGAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 140} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!