ID: 1034459613_1034459632

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1034459613 1034459632
Species Human (GRCh38) Human (GRCh38)
Location 7:151191280-151191302 7:151191331-151191353
Sequence CCCTCTTCCCTCCACACCTGCAG CTTGGCAGGGGCACTGACTCGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 79, 4: 658} {0: 1, 1: 0, 2: 1, 3: 28, 4: 222}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!