ID: 1034466419_1034466444

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1034466419 1034466444
Species Human (GRCh38) Human (GRCh38)
Location 7:151232619-151232641 7:151232668-151232690
Sequence CCCCACGCCTCCGCCCCGCCCCC GTCCTTTATCCGGTGTCCGCCGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 37, 3: 249, 4: 1927} {0: 1, 1: 0, 2: 0, 3: 1, 4: 22}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!