ID: 1034466426_1034466439

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1034466426 1034466439
Species Human (GRCh38) Human (GRCh38)
Location 7:151232632-151232654 7:151232658-151232680
Sequence CCCCGCCCCCTCCCGGGACGCCG GACCCCGGCCGTCCTTTATCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 60, 4: 477} {0: 1, 1: 0, 2: 0, 3: 0, 4: 33}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!