ID: 1034466437_1034466446

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1034466437 1034466446
Species Human (GRCh38) Human (GRCh38)
Location 7:151232644-151232666 7:151232675-151232697
Sequence CCGGGACGCCGGGAGACCCCGGC ATCCGGTGTCCGCCGGCCCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 222} {0: 1, 1: 0, 2: 1, 3: 3, 4: 55}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!