ID: 1034467407_1034467416

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1034467407 1034467416
Species Human (GRCh38) Human (GRCh38)
Location 7:151238212-151238234 7:151238254-151238276
Sequence CCTTCTTTCCAGTCCATTTCCAG CACCACAGAGATCACCCCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 36, 4: 335} {0: 1, 1: 0, 2: 0, 3: 18, 4: 188}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!