ID: 1034471806_1034471815

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1034471806 1034471815
Species Human (GRCh38) Human (GRCh38)
Location 7:151258744-151258766 7:151258763-151258785
Sequence CCCGCCACCTTCTCTCTGCCCTG CCTGGCTTCTGGGCTCCCTGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 12, 3: 92, 4: 851} {0: 1, 1: 0, 2: 9, 3: 73, 4: 559}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!