ID: 1034471806_1034471820

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1034471806 1034471820
Species Human (GRCh38) Human (GRCh38)
Location 7:151258744-151258766 7:151258797-151258819
Sequence CCCGCCACCTTCTCTCTGCCCTG CTCCAGGTCCGTGCCAGCCCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 12, 3: 92, 4: 851} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!