ID: 1034474603_1034474613

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1034474603 1034474613
Species Human (GRCh38) Human (GRCh38)
Location 7:151275277-151275299 7:151275325-151275347
Sequence CCCCAGCGTAGATTCAAGGAGGC CTCCCCGGAGTGGAGGTCTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 56} {0: 1, 1: 0, 2: 0, 3: 18, 4: 184}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!