ID: 1034478497_1034478510

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1034478497 1034478510
Species Human (GRCh38) Human (GRCh38)
Location 7:151302582-151302604 7:151302635-151302657
Sequence CCACGGCACCACTCACCGTCCGG GTCCCCAAGTGGGGAGGGTGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 27, 4: 374}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!