ID: 1034479603_1034479618

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1034479603 1034479618
Species Human (GRCh38) Human (GRCh38)
Location 7:151309197-151309219 7:151309249-151309271
Sequence CCACCCTACCCCAGGTTCATTCC GCTGGCCCAGCGGGTGCTCAGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!