ID: 1034495254_1034495262

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1034495254 1034495262
Species Human (GRCh38) Human (GRCh38)
Location 7:151417037-151417059 7:151417069-151417091
Sequence CCAGACCACAGAGCAGGAACGGG CGGAGCCCAGTGGACTTCCTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 18, 4: 196}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!