ID: 1034499759_1034499767

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1034499759 1034499767
Species Human (GRCh38) Human (GRCh38)
Location 7:151441987-151442009 7:151442026-151442048
Sequence CCCCCATTAGAGTGGTACATTTG TATGTTATACATCGGGATACAGG
Strand - +
Off-target summary {0: 3, 1: 18, 2: 112, 3: 386, 4: 682} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!