ID: 1034507414_1034507417

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1034507414 1034507417
Species Human (GRCh38) Human (GRCh38)
Location 7:151504428-151504450 7:151504452-151504474
Sequence CCCTGCAGAATCTGCATATATGA AAGTCGGCCCTCCATACATGTGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 16, 3: 46, 4: 204}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!