ID: 1034507414_1034507418

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1034507414 1034507418
Species Human (GRCh38) Human (GRCh38)
Location 7:151504428-151504450 7:151504453-151504475
Sequence CCCTGCAGAATCTGCATATATGA AGTCGGCCCTCCATACATGTGGG
Strand - +
Off-target summary No data {0: 1, 1: 5, 2: 21, 3: 95, 4: 372}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!