ID: 1034516977_1034516980 |
View in Genome Browser |
Spacer: 17 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1034516977 | 1034516980 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 7:151588773-151588795 | 7:151588813-151588835 |
| Sequence | CCAGTCACGTGGAACTGTGAGTC | TTTATAAATTACCCAGTCTCAGG |
| Strand | - | + |
| Off-target summary | {0: 36, 1: 862, 2: 5111, 3: 8006, 4: 8083} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||